• Users Online: 244
  • Print this page
  • Email this page


 
 
Table of Contents
ORIGINAL ARTICLE
Year : 2020  |  Volume : 3  |  Issue : 1  |  Page : 6-14

Polygonum multiflorum and Codonopsis pilosula granule alleviates atherosclerosis by inhibiting the expression of DAB2IP-ASK1 pathway in vascular endothelial cells


1 Central Laboratory, Shanghai Geriatric Institute of Chinese Medicine, Shanghai University of Traditional Chinese Medicine, Shanghai, China
2 Department of Vascular Surgery, Xuanwu Hospital, Capital Medical University, Beijing, China

Date of Submission19-Feb-2020
Date of Decision20-Feb-2020
Date of Acceptance28-Feb-2020
Date of Web Publication30-Mar-2020

Correspondence Address:
prof. Chuan Chen
Shanghai Geriatric Institute of Chinese Medicine, Shanghai University of Traditional Chinese Medicine, Shanghai 200031
China
Prof. Te Liu
Shanghai Geriatric Institute of Chinese Medicine, Shanghai University of Traditional Chinese Medicine, Shanghai 200031
China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/VIT.VIT_5_20

Rights and Permissions
  Abstract 


Background: Atherosclerosis is a chronic disease characterized by lipid accumulation, apoptosis and necrosis, smooth muscle cell proliferation and local inflammation. Polygonum multiflorum & Codonopsis pilosula Granule (PmCp Granule), akidney-tonifying compound used in Chinese medicine, has been used for the clinical treatment of atherosclerosis for the past 10 years and exhibits good therapeutic effects.
Aims and Objectives: We want to prove that PmCp Granule inhibits the expression of the DAB2IP-ASK1 pathway in vascular endothelial cells, thereby alleviating the development of atherosclerosis.
Materials and Methods: Blood lipid biochemical test and histopathology H&E staining were used to determine the efficacy of the PmCp Granule. qPCR and western blot were used to determine the expression of DAB2IP-ASK1 pathway.
Results: The results of pathology assay showed that the plaque area, volume fraction of collagen fibers and lipid area in the aortic root was markedly reduced in the PmCp Granule group compared with the Saline group. Besides, the peripheral blood levels of total cholesterol, triglycerides and low-density lipoprotein cholesterol were statistically significantly increased, whereas the high-density lipoprotein cholesterol was statistically significantly decreased in the PmCp Granule group in comparison to the control group. Finally, the results of western blot analysis showed that the expression levels of the proteins related to the DAB2IP-ASK1 pathway were significantly lower in the vascular endothelial cells of PmCp Granule group compared to control group.
Conclusion: the present study demonstrated that PmCp Granule significantly alleviated the development of atherosclerosis in mice. The main mechanism of action of PmCp Granule involved the inhibition of the expression of the DAB2IP-ASK1 pathway in vascular endothelial cells.

Keywords: Atherosclerosis, DAB2IP-ASK1 pathway, p66Shc, Polygonum multiflorum and codonopsis pilosula Granule


How to cite this article:
Zheng J, Zhang H, Guo J, Dou F, Chen J, Yu Z, Chen C, Liu T. Polygonum multiflorum and Codonopsis pilosula granule alleviates atherosclerosis by inhibiting the expression of DAB2IP-ASK1 pathway in vascular endothelial cells. Vasc Invest Ther 2020;3:6-14

How to cite this URL:
Zheng J, Zhang H, Guo J, Dou F, Chen J, Yu Z, Chen C, Liu T. Polygonum multiflorum and Codonopsis pilosula granule alleviates atherosclerosis by inhibiting the expression of DAB2IP-ASK1 pathway in vascular endothelial cells. Vasc Invest Ther [serial online] 2020 [cited 2020 Aug 4];3:6-14. Available from: http://www.vitonline.org/text.asp?2020/3/1/6/281596




  Introduction Top


Atherosclerosis (AS) is a chronic disease characterized by lipid accumulation, apoptosis and necrosis, smooth muscle cell proliferation, and local inflammation.[1],[2],[3],[4] AS represents a major pathologic basis of cardiovascular and cerebrovascular diseases, including coronary heart diseases and stroke. It mainly occurs in the middle-aged and elderly population.[5],[6],[7],[8] The development and progression of AS are closely related to aging and senescence processes.[7],[9],[10] Lipid deposition and vascular endothelial cell dysfunction not only are important pathological factors promoting AS development and progression but also have significant influence on the senescence of other systems in the body.[2],[3],[6],[11] The pathogenesis of AS is very complicated. It is currently believed that AS is closely related to inflammation and lipid infiltration as well as senescence and loss of function of vascular endothelial cells.[2],[3],[6],[11] Vascular endothelial dysfunction is considered to be an initiating factor and central event in cardiovascular diseases, while injury and apoptosis of endothelial cells are the key events leading to vascular endothelial dysfunction.[5],[7],[9],[12],[13],[14],[15],[16] A large number of apoptotic endothelial cells have been detected in animal models of AS and human AS lesions. Moreover, virtually all known risk factors for AS have induced endothelial apoptosis inin vitro andin vivo experiments.[5],[7],[9],[12],[13],[14],[15],[16] There is a close relationship between apoptosis and cell senescence. Apoptosis promotes senescence by destroying irreplaceable cells.[5],[7],[9],[12],[13],[14],[15],[16] P66Shc belongs to the ShcA (Src homology and collagen A) gene family, and p66Shc protein plays an important role in the regulation of cell senescence.[10],[17],[18],[19],[20],[21] P66Shc is capable of inducing apoptosis and necrosis in various types of cells and plays a key role in regulating senescence and the progress of senescence-related senile cardiovascular diseases.[10],[17],[18],[19],[20],[21]

The DOC-2/DAB2 (differentially expressed in ovarian cancer 2/disabled homolog 2) gene is one of the two mammalian orthologs of the Drosophila-disabled (DAB) gene. DOC-2/DAB2 was discovered earlier as a phospholipid-binding protein functioning in the macrophage colony-stimulating factor (CSF-1) signal transduction pathway. The DAB2 gene is a member of the DAB gene family. DAB2 has tumor-suppressing activity and is closely related to the development and progression of a variety of tumors.[22],[23],[24],[25] DOC-2/DAB2 has an interacting protein, DAB2IP (DOC2/DAB2 interactive protein). DAB2IP interacts directly with DAB2, thereby regulating various pathological activities of tumor cells such as proliferation, invasion, and apoptosis.[22],[23],[24],[25] DAB2IP binds to apoptosis signal-regulating kinase 1 (ASK1) through its N-terminus, promotes the dephosphorylation of ASK1 protein at Ser-967, and enhances the activity of ASK1 to activate the p38 mitogen-activated protein kinase (MAPK) and c-Jun N-terminal kinase (JNK) pathways, thus inducing apoptosis.[22],[23],[24],[26],[27],[28],[29],[30],[31] DAB2IP, also known as ASK1-apoptosis interacting protein-1, is a member of the Ras-GTPase activating protein (Ras-GAP) family and a tumor suppressor.[22],[23],[24],[25] DAB2IP contains a protein kinase C conserved region 2 (C2) domain in its amino acid sequence, which binds to ASK1, phosphatase 2A, and vascular endothelial growth factor receptor 2 (VEGFR2).[22],[23],[24],[26],[27],[28],[29],[30],[31] It has been found that DAB2IP promotes the tumor necrosis factor (TNF)-induced activation of the ASK1-JNK pathway in endothelial cells by activating the downstream TNF receptor 1 (TNFR1)/TNFR1-associated death domain protein/receptor interacting protein 1/TNF receptor-associated factor 2 complex, resulting in endothelial cell injury and apoptosis.[22],[23],[24],[26],[27],[28],[29],[30],[31] Zhang et al. have found that ASK1 dissociates from the 14-3-3 protein after dephosphorylation at Ser967, downregulates the VEGF level, and ultimately inhibits angiogenesis in human osteosarcoma.[23] Ji et al. injected cancer cells subcutaneously into the right posterior abdomen of DAB2IP−/− mice. Following tumorigenesis, the tumors were isolated. Angiogenesis and lymphangiogenesis in the tumors were examined by immunostaining. Ji et al. found that tumor neovasculature formation was extremely active in DAB2IP knockout mice.[32] In addition, Ji et al. demonstrated that the above phenomenon was related to the increased VEGFR2 signaling in vascular endothelial cells.[32] Using melanoma and breast cancer models, Ji et al. showed that DAB2IP blocked VEGFR2-dependent signal transduction via directly binding to the phosphotyrosine residues within the activation loop of VEGFR2, thereby ultimately inhibiting epithelial–mesenchymal transition, tumor angiogenesis, tumor growth, and tumor metastasis.[32]

An increasing number of studies have demonstrated that Chinese herbal medicine produces significant therapeutic benefit when used to treat and delay the development and progression of AS.[1] The kidney-tonifying Chinese medicine compound Polygonum multiflorum and Codonopsis pilosula Granule (PmCp Granule) was internally prepared in our institution. PmCp Granule mainly targets the senescence process of vascular endothelial cells and abnormal lipid metabolism during AS development and progression. The main purpose of developing PmCp Granule is to tonify the kidney and delay senescence.[7] PmCp Granule is composed of P. multiflorum, Fructus Lycii, Panax notoginseng, and Crataegus pinnatifida. PmCp Granule has been used in the clinical treatment of AS for the past 10 years and has exhibited good therapeutic effects. However, the specific mechanisms of action of PmCp Granule remain unclear. Based on the above evidence, the present study intended to establish a senescence-related AS model via feeding ApoE−/− and p66shc−/+ double transgenic mice a high-fat diet. Subsequently, the model mice were subjected to intervention with PmCp Granule. The purpose of the present study was to verify the hypothesis that PmCp Granule alleviated AS development by inhibiting the expression of the DAB2IP-ASK1 pathway in vascular endothelial cells.


  Materials and Methods Top


Drugs and reagents

The PmCp Granule was prepared from the following ingredients: 15 g of Fructus Lycii, 15 g of P. multiflorum, 15 g of C. pinnatifida, and 3 g of Panax notoginseng. Pravastatin 40-mg tablets (batch number H20060271) were obtained from Daiichi Sankyo Pharmaceutical (Shanghai) Co., Ltd. Mouse monoclonal anti-DAB2IP, anti-ASK1, anti-phospho-ASK1 (p-ASK1), anti-p38, anti-phospho-p38 (p-p38), anti-macrophage stimulating 1 (MST1), and anti-glyceraldehyde 3-phosphate dehydrogenase antibodies were purchased from Abcam. TC, TG, high-density lipoprotein-cholesterol (HDL-C), and low-density lipoprotein-cholesterol (LDL-C) assay kits were purchased from NanJing JianCheng Bioengineering Institute.

Animal grouping and drug intervention

A total of 44 specific pathogen-free (SPF)-grade ApoE−/−/p66−/+ C57/BALB mice were purchased from the Shanghai Research Center for Model Organisms (license number SCXK [Shanghai] 2014-0002). The mice were 6–8 weeks of age and weighed 30 ± 5 g. After 1 week of adaptive feeding with an ordinary diet, the ApoE−/−/p66−/+ C57/BABL mice were randomly divided into four groups as follows: blank control (mice fed a standard diet), saline model control (mice receiving a high-fat diet and an equal volume of normal saline), pravastatin (mice given the high-fat diet and 1.8 mg/kg pravastatin), and PmCp Granule (mice given the high-fat diet and 8 g/kg PmCp Granule). Each group contained 11 mice. The intervention period lasted 15 weeks.

Hematoxylin and eosin staining

The pathological morphology of the mouse aortic tissues was examined by hematoxylin and eosin (H and E) staining. Mouse aorta was fixed in 10% formaldehyde, and the aortic arch was excised approximately 0.5 cm away from the aortic root. Subsequently, the aorta was routinely dehydrated, embedded in paraffin, serially sectioned at 5-μm thickness (starting from the aortic root), and stained with H and E. The pathological morphology of the aortic tissues was examined under a light microscope.

Masson's trichrome staining

Aortic root sections with atherosclerotic plaques were dewaxed, washed with double-distilled water for 5 min, and incubated with hematoxylin solution for 5–10 min. Following nuclear staining with hematoxylin, the sections were washed thoroughly and stained with Masson's ponceau-acid fuchsin solution for 6–10 min. Subsequently, the sections were washed with 2% glacial acetic acid solution for 5 s, differentiated in 1% phosphomolybdic acid solution for 3–5 min, and stained by direct immersion in aniline blue solution for 5 min. The sections were then washed with 0.2% glacial acetic acid solution for a few seconds, cleared, sealed, and imaged.

Gross staining with oil red O

After washing away the fixative solution with phosphate-buffered saline (PBS), the tissues were immersed in 60% isopropanol for 3 h and then rinsed three times with distilled water (3–4 min each time). Subsequently, the aortas were stained by immersion in oil red O solution for 45 min−1 h, differentiated in 60% isopropanol until the background color turned white, and washed with distilled water.

Fluorescence-based real-time-quantitative polymerase chain reaction

Total RNA was extracted from each group of cells using TRIzol Reagent(Invitrogen Life Technologies, Carlsbad, CA, USA) in accordance with the manufacturer's instructions. After being treated with DNase I (Sigma-Aldrich, St Louis, MO, USA), total RNA was quantified and reverse transcribed into complementary DNAs (cDNAs) using the ReverTra Ace-αFirst Strand cDNA Synthesis Kit (Toyobo (Shanghai) Biotech Co., Ltd., Shanghai, China). Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was completed using the RealPlex 4 real-time PCR detection system (Eppendorf, Hamburg, Germany), and SyBR Green RealTime PCR Master Mix (TOYOBO) was used as the fluorescent dye in nucleic acid amplification. During qRT-PCR, a total of forty cycles of amplification were performed: denaturation at 95°C for 15 s; annealing at 58°C for 30 s; and elongation at 72°C for 42 s. The relative gene expression level was determined using the 2ΔΔCt method. Specifically, ΔCt = Ct_genes-Ct_18sRNA, while ΔΔCt = ΔCt_all_groups-ΔCt_blankcontrol_group. The mRNA expression levels were adjusted based on the expression level of 18s rRNA. The following primers were used to amplify the genes: DAB2IP-F, AGGGATAGGCTAAGGAGTAAGG; DAB2IP-R, TGGCACTTGAACAGGGTCTC; ASK1-F, TTTAGTGCCTCTTCTGTCA; ASK1-R, CTCTTCGGTAATGGTGTT; MST1-F, AGCGGAATACAGTGATAGG; MST1-R, ATGTGGGAGGAGGATTTG; p38-F, CCCAAATGCTGACTCCAA; p38-R, GGGTCGTAATACTGCTCC; JNK-F, AGAAGCAAGCGTGACAAC; JNK-R, AAGAATGGCATCATAAGC; p66Shc-F, CATCCCAACGACAAAGTCATG; p66Shc-R, TCGCATTGACTGTAAGACCTC; 18s rRNA-F, GGAGAAACCTGCCAAGTATGA; and 18s rRNA-R, CAACCTGGTCCTCAGTGTAGC.

Western blot

Briefly, total proteins extracted from various group of cells were subjected to denaturing sodium dodecyl sulfate-polyacrylamide gel electrophoresis on a 12% gel. Following electrophoresis, the proteins were transferred to polyvinylidene fluoride membranes (Millipore, Bedford, MA, USA). The membranes were blocked, washed, and incubated with primary antibodies at 37°C for 45 min. After sufficient washing, the membranes were incubated with secondary antibody (horseradish peroxidase-labeled polyclonal anti-mouse immunoglobulin G [IgG] antibody) at 37°C for 45 min. The membranes were washed four times with Tris-buffered saline-Tween 20 at room temperature (RT) for 14 min each. Subsequently, the blots were visualized using the enhanced chemiluminescence assay (Beyotime Biotechnology, HangZhou, China). All other chemicals were purchased from Sigma-Aldrich.

Immunofluorescence staining

Five mice were randomly selected from each group, and aortic root segments containing atherosclerotic plaques were collected. The aortic segments were dehydrated, cleared, embedded in paraffin, and sectioned. The sections were dewaxed and rehydrated. To achieve antigen retrieval, the sections were placed in citrate buffer and heated in a boiling water bath for 10 min. The sections were then cooled gradually at RT. The above procedure was repeated once. After cooling down to RT, the sections were blocked with 5% bovine serum albumin at RT for 2 h. After blocking, the sections were incubated with the corresponding goat anti-rabbit polyclonal antibodies (diluted 1:50) for 1 h and then at 4°C overnight with shaking. The sections were washed with PBS for 15 min and incubated with fluorescein isothiocyanate-labeled monoclonal anti-mouse IgG antibody (which was mixed with the blocking solution at a ratio of 1:500) at RT for 1 h. The sections were washed with PBS solution for 45 min, covered with anti-fade mounting medium containing 4',6-diamidino-2-phenylindole, and mounted on slides. The stained sections were examined under a fluorescence microscope using the standard 488-nm excitation.

Examination of blood lipid levels

Mouse peripheral blood was collected, placed at 4°C for 4 h, and then centrifuged at 4°C and 10,000 r/min for 10 min. The resulting supernatants were collected. Serum TC, TG, HDL-C, and LDL-C levels were examined using commercial kits in accordance with the manufacturer's instructions.

Statistical analysis

Each experiment was performed as least three times, and data were shown as mean ± standard error. The differences were evaluated using Student's t-test. P < 0. 05 was considered statistically significant.


  Results Top


Polygonum multiflorum and Codonopsis pilosula Granule effectively ameliorated aortic root lesions in ApoE−/− and p66shc−/+ mice

H and E staining revealed the formation of apparent fatty streaks in the aortic roots of the mice from the WT group. Aggregates of foam cells and small plaques were also observed in the aortic roots of WT mice. The above findings indicate that the lesions in the WT mice were mainly in the early transitional period of plaque development [Figure 1]. In the saline group, a large number of atherosclerotic plaques had developed at the aortic root. Moreover, a certain number of plaques were on the verge of rupture. The findings indicate that the lesions in the saline group had advanced into the atherosclerotic plaque stage. Compared with the WT group, the saline group exhibited a significantly increased area of plaques [Figure 1]. In contrast, the area of atherosclerotic plaques was markedly reduced in the PmCp Granule group compared to the saline group. The number of plaques on the verge of rupture was also significantly reduced in the PmCp Granule group [Figure 1]. The findings indicated that the lesions were mainly in the fibrous plaque stage. Thus, PmCp Granule significantly ameliorated the severity of aortic root lesions in ApoE−/− and p66shc−/+ mice that were fed a high-fat diet.
Figure 1: Polygonum multiflorum and Codonopsis pilosula Granule effectively ameliorates aortic root lesions in ApoE−/− and p66shc−/+ mice. The results of H and E staining showed that the area of AS plaques had significantly shrunk, and the number of plaques on the verge of rupture was markedly reduced in the Polygonum multiflorum and Codonopsis pilosula Granule group. The lesions developed in the Polygonum multiflorum and Codonopsis pilosula Granule group were mainly in the fibrous plaque stage. **P < 0.01 versus the WT group, *P < 0.05 versus the WT group,##P < 0.01 versus the saline group,#P < 0.05 versus the WT group; t-test

Click here to view


Polygonum multiflorum and Codonopsis pilosula Granule effectively regulated the proportion of labile collagen fibers in the plaques at the aortic roots of ApoE−/− and p66shc−/+ mice

Masson staining revealed a small amount of collagen deposition in the aortic root plaques in the WT group [Figure 2]. Compared with the WT group, mice in the saline group exhibited significantly increased collagen fiber content in aortic root plaques [Figure 2]. In contrast, the proportion of labile collagen fibers in the aortic root plaques was significantly reduced in the PmCp Granule group compared with the saline group [Figure 2]. Thus, PmCp Granule significantly reduced the proportion of labile collagen fibers in the plaques at the aortic roots of ApoE−/− and p66shc−/+ mice that were fed a high-fat diet.
Figure 2: Polygonum multiflorum and Codonopsis pilosula Granule effectively regulates the proportion of labile collagen fibers in the plaques at the aortic roots of ApoE−/− and p66shc−/+ mice. MASSON staining revealed that the proportion of labile collagen fibers in the aortic root plaques was significantly reduced in the Polygonum multiflorum and Codonopsis pilosula Granule group. **P < 0.01 versus the WT group, *P < 0.05 versus the WT group,##P < 0.01 versus the Saline group,#P < 0.05 versus the WT group; t-test

Click here to view


Polygonum multiflorum and Codonopsis pilosula Granule effectively reduced the percent of the aortic area containing lipid deposits in ApoE−/− and p66shc−/+ mice

Gross staining with oil red O showed that there was virtually no significant lipid deposition in the aortas of the mice from the WT group [Figure 3]. Compared with the WT group, mice in the saline group exhibited a significantly increased percent area of lipid deposition in the aortas [Figure 3]. However, the percent of the aortic area containing lipid deposits was markedly reduced in the PmCp Granule group compared to the saline group [Figure 3]. Thus, it can be concluded that PmCp Granule effectively reduced the percent of lipid deposition area in the aorta of ApoE−/− and p66shc−/+ mice receiving a high-fat diet.
Figure 3: Polygonum multiflorum and Codonopsis pilosula Granule effectively reduces the percent of the aortic area containing lipid deposits and blood lipid levels in ApoE−/− and p66shc−/+ mice. (a) Gross staining with oil red O showed that the percent area of lipid deposition in the aorta was markedly reduced in the Polygonum multiflorum and Codonopsis pilosula Granule group. **P < 0.01 versus WT group, *P < 0.05 versus WT group,##P < 0.01 versus Saline group,#P < 0.05 versus WT group; t-test. (b) Polygonum multiflorum and Codonopsis pilosula Granule significantly improves blood lipid profile in ApoE−/− and p66shc−/+ mice. Serum TG, TC and LDL-C levels were markedly reduced while serum HDL-C level was significantly elevated in the Polygonum multiflorum and Codonopsis pilosula Granule group. **P < 0.01 versus the WT group, *P < 0.05 versus the WT group,##P < 0.01 versus the Saline group,#P < 0.05 versus the WT group; t-test

Click here to view


Polygonum multiflorum and Codonopsis pilosula Granule significantly improved blood lipid profiles in ApoE−/− and p66shc−/+ mice

Compared with WT group, mice in the saline group exhibited significantly elevated TG, TC, and LDL-C levels in the peripheral blood. However, HDL-C level was significantly reduced in the saline group [Figure 3]. In contrast, serum TG, TC, and LDL-C levels were markedly reduced, while serum HDL-C level was drastically increased in the PmCp Granule group in comparison with the saline group [Figure 3]. The experimental results showed that PmCp Granule significantly improved the blood lipid profile in ApoE−/− and p66shc−/+ mice receiving a high-fat diet.

Polygonum multiflorum and Codonopsis pilosula Granule effectively inhibited the activation of the DAB2IP-ASK1 pathway in the vascular endothelial cells of ApoE−/− andp66shc−/+ mice

The results of qPCR showed that there were no statistically significant differences in the mRNA expression of the key factors of the DAB2IP-ASK1 pathway between the WT, saline, and drug intervention groups [Figure 4]. However, Western blot results showed that the protein expression levels of the key factors in the DMB2IP-ASK1 pathway (including DAB2IP, ASK1, phosphor-ASK1 [p-ASK1], p38MAPK, phosphor-p38MAPK [p-p38MAPK], and macrophage stimulating 1 [MST1]) were significantly lower in the PmCp Granule group compared to that of the saline group [Figure 4]. In addition, immunofluorescence staining showed that two proteins, ASK1 and p38MAPK, were highly expressed in the aortic roots of the mice in the saline group. However, ASK1 and p38MAPK expression significantly decreased in the PmCp Granule group [Figure 4]. Therefore, it can be concluded that PmCp Granule effectively inhibited the activation of the DAB2IP-ASK1 pathway in the vascular endothelial cells of ApoE−/− and p66shc−/+ mice receiving a high-fat diet.
Figure 4: Polygonum multiflorum and Codonopsis pilosula Granule effectively inhibits the activation of the DAB2IP-ASK1 pathway in vascular endothelial cells of ApoE−/− and p66shc−/+ mice. (a) The qPCR results showed that there were no statistically significant differences in the expression of the key factors of the DAB2IP-ASK1 pathway at the mRNA level between the WT, saline and drug intervention groups. (b) Western blot results showed that the protein expression levels of the key factors of the DAB2IP-ASK1 pathway were significantly decreased in the vascular endothelial cells of the mice of the Polygonum multiflorum and Codonopsis pilosula Granule group. (c) Immunofluorescence staining showed that the expression of two proteins, ASK1 and p38MAPK, was markedly reduced in the Polygonum multiflorum and Codonopsis pilosula Granule group

Click here to view



  Discussion Top


AS is a typical cardiovascular disease, and its pathogenesis is very complicated. At present, certain studies suggest that the senescence and apoptosis of vascular endothelial cells play an important role in promoting AS development and progression.[1],[2],[3],[6],[11],[12],[16] Many studies have shown that p66Shc significantly promotes cell senescence and apoptosis.[10],[17],[18],[19],[20],[21] Our previous study found that p66Shc expression was significantly upregulated when vascular endothelial cells were damaged by oxidative stress. In-depth investigation revealed that the three prime untranslated region (3'-UTR) of the senescence-promoting factors p16 and p66Shc underwent NSUN2 (NOP2/Sun domain family, member 2)-catalyzed methylation modification.[10] In addition, P66Shc expression significantly increased in vascular endothelial cells during the development of AS, indicating that P66Shc expression was positively correlated with the occurrence of AS.[10],[19],[21] However, it is not yet clear whether inhibition of the expression of endogenous p66Shc would reduce the development and progression of AS. Therefore, we generated heterozygous p66Shc knockout mice. In addition, to attain the pathological features of AS, p66Shc−/+ mice were mated with the classical ApoE−/− mice to generate the ApoE−/− and p66shc−/+ mice. After feeding a high-fat diet, apparent lipid and plaque deposition was observed in the aortic roots of the ApoE−/− and p66shc−/+ mice, which were accompanied by significant accumulation of labile collagen. Moreover, the peripheral blood levels of TG, TC, and HDL were significantly elevated in ApoE−/− and p66shc−/+ mice. The above pathological features were in good agreement with the pathological features of human AS. Therefore, it can be concluded that the ApoE−/− and p66shc−/+ mice developed typical pathologic characteristics of AS after receiving a high-fat diet.

Subsequently, the mice with AS were given the Chinese medicine compound PmCp Granule and pravastatin. Consistent with other studies, pravastatin exhibited a significant therapeutic effect on AS symptoms in ApoE−/− and p66shc−/+ mice. The present study focused on PmCp Granule. PmCp Granule significantly reduced lipid deposition in the aortic root, fibrosis of vascular endothelial cells, and the area of labile collagen in ApoE−/− and p66shc−/+ mice stimulated with a high-fat diet. In addition, PmCp Granule significantly downregulated the levels of TG, TC, and HDL in the peripheral blood of ApoE−/− and p66shc−/+ mice with AS. PmCp Granule was not as potent as pravastatin in relieving the symptoms of AS. However, statistically significant differences were observed between the PmCp Granule group and the model group.

At last, the present study analyzed the mechanisms by which PmCp Granule alleviated the symptoms of AS. It was found that the expression of the endogenous DAB2IP-ASK1 pathway was significantly decreased in the vascular endothelial cells of the atherosclerotic ApoE−/− and p66shc−/+ mice after PmCp granule intervention. Although the mRNA levels of the key factors in the DAB2IP-ASK1 pathway did not change significantly, the differences in the expression of the phosphorylated proteins were significant. The DAB2IP-ASK1 pathway contains key factors such as DAB2IP, ASK1, p-ASK1, p38MAPK, p-p38MAPK, and MST1, among which ASK1, p38MAPK, and MST1 are typical kinases. The results of Western blot analysis showed that the expression levels of these key factors significantly increased in the model group. However, the expression levels of these factors were markedly reduced in the PmCp Granule intervention group. When the expression levels of the kinases in the DAB2IP-ASK1 pathway decreased, the levels of the substrates catalyzed by the kinases decreased accordingly. Eventually, a cascade reaction was triggered, resulting in a decrease in the activity of the entire DAB2IP-ASK1 signaling pathway.

In the present study, heterozygous knockout of p66Shc expression in mice was achieved. However, the ApoE−/− and p66shc−/+ mice still developed AS upon stimulation with a high-fat diet. The results demonstrated that the occurrence of AS was the result of the combined action of multiplefactors. Although downregulation of p66Shc expression delayed the senescence process of vascular endothelial cells, stimuli such as hyperlipidemia and inflammation also play important roles in AS development and progression. Our study also indirectly confirmed the complexity of the pathogenesis of AS.


  Conclusion Top


The present study demonstrated that PmCp Granule significantly alleviated the development of AS in mice. The main mechanism of action of PmCp Granule involved inhibition of the expression of the DAB2IP-ASK1 pathway in vascular endothelial cells.

Acknowledgments

This work was supported by grant from the National Natural Science Foundation of China (No. 81973899). Moreover, support was provided by grant from the projects sponsored by the development fund for Shanghai talents (2017054) and grant from the projects sponsored by the fund for Xinglin talents of Shanghai University of traditional Chinese medicine (TCM) (201707081). The study was also supported by grant from 3-year action plan for accelerating the development of TCM in Shanghai (ZY[2018-2020)-CCCX-4004).

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Liu Q, Li J, Hartstone-Rose A, Wang J, Li J, Janicki JS, et al. Chinese herbal compounds for the prevention and treatment of atherosclerosis: Experimental evidence and mechanisms. Evid Based Complement Alternat Med 2015;2015:752610.  Back to cited text no. 1
    
2.
Bories GF, Leitinger N. Macrophage metabolism in atherosclerosis. FEBS Lett 2017;591:3042-60.  Back to cited text no. 2
    
3.
Wong BW, Marsch E, Treps L, Baes M, Carmeliet P. Endothelial cell metabolism in health and disease: Impact of hypoxia. EMBO J 2017;36:2187-203.  Back to cited text no. 3
    
4.
Zhang Y, Ren P, Kang Q, Liu W, Li S, Li P, et al. Effect of tetramethylpyrazine on atherosclerosis and SCAP/SREBP-1c signaling pathway in ApoE(−/−) mice fed with a high-fat diet. Evid Based Complement Alternat Med 2017;2017:3121989.  Back to cited text no. 4
    
5.
Seimon TA, Nadolski MJ, Liao X, Magallon J, Nguyen M, Feric NT, et al. Atherogenic lipids and lipoproteins trigger CD36-TLR2-dependent apoptosis in macrophages undergoing endoplasmic reticulum stress. Cell Metab 2010;12:467-82.  Back to cited text no. 5
    
6.
Xu H, Shi D, Chen K. Atherosclerosis: An integrative East-West medicine perspective. Evid Based Complement Alternat Med 2012;2012:148413.  Back to cited text no. 6
    
7.
Shen DZ, Xin SL, Chen C, Liu T. Effect of atorvastatin on expression of TLR4 and NF-κB p65 in atherosclerotic rabbits. Asian Pac J Trop Med 2013;6:493-6.  Back to cited text no. 7
    
8.
Chen Z, Xu H. Anti-Inflammatory and Immunomodulatory Mechanism of Tanshinone IIA for Atherosclerosis. Evid Based Complement Alternat Med 2014;2014:267976.  Back to cited text no. 8
    
9.
Liu T, Shen D, Xing S, Chen J, Yu Z, Wang J, et al. Attenuation of exogenous angiotensin II stress-induced damage and apoptosis in human vascular endothelial cells via microRNA-155 expression. Int J Mol Med 2013;31:188-96.  Back to cited text no. 9
    
10.
Cai X, Hu Y, Tang H, Hu H, Pang L, Xing J, et al. RNA methyltransferase NSUN2 promotes stress-induced HUVEC senescence. Oncotarget 2016;7:19099-110.  Back to cited text no. 10
    
11.
Wong W. Protected from atherosclerosis by TFEB. Science 2017;355:490.  Back to cited text no. 11
    
12.
Chen DW, Jin Y, Zhao RM, Long LJ, Zhang J, Han CL, et al. Age-, sex- and glucose-dependent correlation of plasma soluble vascular adhesion protein-1 concentration with cardiovascular risk factors and subclinical atherosclerosis. Eur Rev Med Pharmacol Sci 2016;20:1544-58.  Back to cited text no. 12
    
13.
Betge S, Kretzschmar D, Figulla HR, Lichtenauer M, Jung C. Predictive value of the augmentation index derived vascular age in patients with newly diagnosed atherosclerosis. Heart Vessels 2017;32:252-9.  Back to cited text no. 13
    
14.
Chen S, Yang Y, Cheng GL, Jia J, Fan FF, Li JP, et al. Association between short sleep duration and carotid atherosclerosis modified by age in a Chinese community population. J Epidemiol Community Health 2018;72:539-44.  Back to cited text no. 14
    
15.
Reis JP, Allen NB, Bancks MP, Carr JJ, Lewis CE, Lima JA, et al. Duration of diabetes and prediabetes during adulthood and subclinical atherosclerosis and cardiac dysfunction in middle age: The CARDIA study. Diabetes Care 2018;41:731-8.  Back to cited text no. 15
    
16.
VanderBurgh JA, Reinhart-King CA. The role of age-related intimal remodeling and stiffening in atherosclerosis. Adv Pharmacol 2018;81:365-91.  Back to cited text no. 16
    
17.
Chen Z, Wang G, Zhai X, Hu Y, Gao D, Ma L, et al. Selective inhibition of protein kinase C β2 attenuates the adaptor P66 Shc-mediated intestinal ischemia-reperfusion injury. Cell Death Dis 2014;5:e1164.  Back to cited text no. 17
    
18.
Paneni F, Costantino S, Cosentino F. P66(Shc)-induced redox changes drive endothelial insulin resistance. Atherosclerosis 2014;236:426-9.  Back to cited text no. 18
    
19.
Spescha RD, Glanzmann M, Simic B, Witassek F, Keller S, Akhmedov A, et al. Adaptor protein p66(Shc) mediates hypertension-associated, cyclic stretch-dependent, endothelial damage. Hypertension 2014;64:347-53.  Back to cited text no. 19
    
20.
Fadini GP, Albiero M, Bonora BM, Poncina N, Vigili de Kreutzenberg S, Avogaro A. p66Shc gene expression in peripheral blood mononuclear cells and progression of diabetic complications. Cardiovasc Diabetol 2018;17:16.  Back to cited text no. 20
    
21.
Wright KD, Staruschenko A, Sorokin A. Role of adaptor protein p66Shc in renal pathologies. Am J Physiol Renal Physiol 2018;314:F143-53.  Back to cited text no. 21
    
22.
Zhang H, Zhang R, Luo Y, D'Alessio A, Pober JS, Min W. AIP1/DAB2IP, a novel member of the Ras-GAP family, transduces TRAF2-induced ASK1-JNK activation. J Biol Chem 2004;279:44955-65.  Back to cited text no. 22
    
23.
Zhang H, Zhang H, Lin Y, Li J, Pober JS, Min W. RIP1-mediated AIP1 phosphorylation at a 14-3-3-binding site is critical for tumor necrosis factor-induced ASK1-JNK/p38 activation. J Biol Chem 2007;282:14788-96.  Back to cited text no. 23
    
24.
Xie D, Gore C, Zhou J, Pong RC, Zhang H, Yu L, et al. DAB2IP coordinates both PI3K-Akt and ASK1 pathways for cell survival and apoptosis. Proc Natl Acad Sci U S A 2009;106:19878-83.  Back to cited text no. 24
    
25.
Xie D, Gore C, Liu J, Pong RC, Mason R, Hao G, et al. Role of DAB2IP in modulating epithelial-to-mesenchymal transition and prostate cancer metastasis. Proc Natl Acad Sci U S A 2010;107:2485-90.  Back to cited text no. 25
    
26.
Liu Y, Yin G, Surapisitchat J, Berk BC, Min W. Laminar flow inhibits TNF-induced ASK1 activation by preventing dissociation of ASK1 from its inhibitor 14-3-3. J Clin Invest 2001;107:917-23.  Back to cited text no. 26
    
27.
Zhang R, Luo D, Miao R, Bai L, Ge Q, Sessa WC, et al. Hsp90-Akt phosphorylates ASK1 and inhibits ASK1-mediated apoptosis. Oncogene 2005;24:3954-63.  Back to cited text no. 27
    
28.
Min W, Lin Y, Tang S, Yu L, Zhang H, Wan T, et al. AIP1 recruits phosphatase PP2A to ASK1 in tumor necrosis factor-induced ASK1-JNK activation. Circ Res 2008;102:840-8.  Back to cited text no. 28
    
29.
Li X, Luo Y, Yu L, Lin Y, Luo D, Zhang H, et al. SENP1 mediates TNF-induced desumoylation and cytoplasmic translocation of HIPK1 to enhance ASK1-dependent apoptosis. Cell Death Differ 2008;15:739-50.  Back to cited text no. 29
    
30.
Um JW, Im E, Park J, Oh Y, Min B, Lee HJ, et al. ASK1 negatively regulates the 26 S proteasome. J Biol Chem 2010;285:36434-46.  Back to cited text no. 30
    
31.
Yin M, Zhou HJ, Zhang J, Lin C, Li H, Li X, et al. ASK1-dependent endothelial cell activation is critical in ovarian cancer growth and metastasis. JCI Insight 2017;2:1-8.  Back to cited text no. 31
    
32.
Ji W, Li Y, Wan T, Wang J, Zhang H, Chen H, et al. Both internalization and AIP1 association are required for tumor necrosis factor receptor 2-mediated JNK signaling. Arterioscler Thromb Vasc Biol 2012;32:2271-9.  Back to cited text no. 32
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
Conclusion
References
Article Figures

 Article Access Statistics
    Viewed498    
    Printed48    
    Emailed0    
    PDF Downloaded92    
    Comments [Add]    

Recommend this journal